Review





Similar Products

monoclonal antibody based sandwich immunoassays undercarboxylated oc eia kit catalog no mk118 and gla type oc eia kit catalog no mk111 takara bio inc  (TaKaRa)
94
TaKaRa monoclonal antibody based sandwich immunoassays undercarboxylated oc eia kit catalog no mk118 and gla type oc eia kit catalog no mk111 takara bio inc
Monoclonal Antibody Based Sandwich Immunoassays Undercarboxylated Oc Eia Kit Catalog No Mk118 And Gla Type Oc Eia Kit Catalog No Mk111 Takara Bio Inc, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal antibody based sandwich immunoassays undercarboxylated oc eia kit catalog no mk118 and gla type oc eia kit catalog no mk111 takara bio inc/product/TaKaRa
Average 94 stars, based on 1 article reviews
monoclonal antibody based sandwich immunoassays undercarboxylated oc eia kit catalog no mk118 and gla type oc eia kit catalog no mk111 takara bio inc - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
anti beta catenin  (Boster Bio)
95
Boster Bio anti beta catenin
Anti Beta Catenin, supplied by Boster Bio, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti beta catenin/product/Boster Bio
Average 95 stars, based on 1 article reviews
anti beta catenin - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier
rabbit anti erk  (Boster Bio)
94
Boster Bio rabbit anti erk
Rabbit Anti Erk, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti erk/product/Boster Bio
Average 94 stars, based on 1 article reviews
rabbit anti erk - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
anti ubiquitin antibody based affinity purification system  (Cell Signaling Technology Inc)
96
Cell Signaling Technology Inc anti ubiquitin antibody based affinity purification system
Anti Ubiquitin Antibody Based Affinity Purification System, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ubiquitin antibody based affinity purification system/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
anti ubiquitin antibody based affinity purification system - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier
antibody based immunoprecipitation  (Cell Signaling Technology Inc)
94
Cell Signaling Technology Inc antibody based immunoprecipitation
(A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. <t>PLD1-associated</t> protein complexes were isolated <t>via</t> <t>antibody-based</t> pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.
Antibody Based Immunoprecipitation, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody based immunoprecipitation/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
antibody based immunoprecipitation - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga  (Bethyl)
94
Bethyl sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga
(A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. <t>PLD1-associated</t> protein complexes were isolated <t>via</t> <t>antibody-based</t> pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.
Sequence Based Reagents Crispr Target Sequence For Camkiiγ Human 5 ́ Gtgctgatcctcatcccaga, supplied by Bethyl, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga/product/Bethyl
Average 94 stars, based on 1 article reviews
sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
antibody based elisa kits  (R&D Systems)
94
R&D Systems antibody based elisa kits
(A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. <t>PLD1-associated</t> protein complexes were isolated <t>via</t> <t>antibody-based</t> pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.
Antibody Based Elisa Kits, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody based elisa kits/product/R&D Systems
Average 94 stars, based on 1 article reviews
antibody based elisa kits - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
anti beta actin actb antibody  (Boster Bio)
95
Boster Bio anti beta actin actb antibody
(A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. <t>PLD1-associated</t> protein complexes were isolated <t>via</t> <t>antibody-based</t> pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.
Anti Beta Actin Actb Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti beta actin actb antibody/product/Boster Bio
Average 95 stars, based on 1 article reviews
anti beta actin actb antibody - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier
inos antibody  (Boster Bio)
94
Boster Bio inos antibody
(A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. <t>PLD1-associated</t> protein complexes were isolated <t>via</t> <t>antibody-based</t> pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.
Inos Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/inos antibody/product/Boster Bio
Average 94 stars, based on 1 article reviews
inos antibody - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

Image Search Results


(A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. PLD1-associated protein complexes were isolated via antibody-based pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.

Journal: bioRxiv

Article Title: Exploring the PLD1-tau interaction in Frontotemporal Dementia

doi: 10.64898/2026.02.12.705569

Figure Lengend Snippet: (A) Schematic of the experimental workflow. Human temporal lobe (BA38) tissues from FTD and control subjects were homogenized and fractionated to obtain cytosolic (S2) and crude synaptoneurosomal (P2) compartments. PLD1-associated protein complexes were isolated via antibody-based pull-down, validated by Western blotting, and subjected to LC–MS/MS for identification and quantification of PLD1-interacting proteins. (B) Principal component analysis (PCA) plots of cytosolic and crude synaptoneurosomal fractions show clear separation between FTD and control samples, indicating reproducible compartment-specific proteomic differences (Mahalanobis CV ≈ 45–46%). (C) Differential abundance analysis (volcano plots) highlights significant up- and down-regulated proteins in both compartments. In the cytosolic fraction, elevated levels of metabolic and lipid-signaling enzymes (DGKB, GUCY1B1, HDHD2), stress proteins (HSPA2), and GFAP, a canonical astrocytic marker, were observed, indicating increased glial and inflammatory activity. Decreased cytosolic PIN1 supports a permissive background for Tau misfolding. In the crude synaptoneurosomal fraction, presynaptic scaffolds (PCLO, PPFIA3), vesicle-trafficking regulators (SNX17, SLC32A1), and mitochondrial import components (TOMM20/40) were markedly reduced, suggesting synaptic vesicular and energy-transfer deficits. (D) Heatmaps of protein expression patterns illustrate coherent compartment-specific shifts. Cytosolic profiles exhibit upregulation of metabolic and glial-response modules, including GFAP, while crude synaptoneurosomal clusters show concerted downregulation of trafficking and proteostasis regulators (PSMC4, PSMD13, OPTN, SNX17). (E) Cross-compartment integration analysis maps cytosolic versus crude synaptoneurosomal log₂ fold changes, revealing that 37.4 % of proteins fall within the Syn − /Cyto + quadrant—proteins reduced at synapses but increased in the cytosol—consistent with trafficking and degradative impairments. GFAP lies within this quadrant, reflecting redistribution or compensatory cytosolic upregulation associated with glial reactivity and neuronal stress. (F) Gene Ontology enrichment analysis shows that cytosolic changes are dominated by lipid metabolism, cyclic-nucleotide synthesis, cytoskeletal remodeling, and stress-response pathways (including astrocyte activation), whereas crude synaptoneurosomal alterations involve vesicle trafficking, proteasome regulation, and Tau- and phosphatidylinositol-binding proteins.

Article Snippet: PLD1-associated protein complexes were isolated from crude synaptoneurosomal fractions (BA38) of FTD and control brains using antibody-based immunoprecipitation (PLD1, CST #3832S) and magnetic bead capture.

Techniques: Control, Isolation, Western Blot, Liquid Chromatography with Mass Spectroscopy, Marker, Activity Assay, Expressing, Activation Assay, Binding Assay